Skip to main content

Advertisement

Table 1 Details of primer sequences used in qPCR analysis

From: The actions of exogenous leucine on mTOR signalling and amino acid transporters in human myotubes

Gene of interest Genbank Accession Numbers Sequences of primers Amplicon length (bp)
Cyclophilin NM_021130.3 FP: 5' CATCTGCACTGCCAAGACTGA 3' 72
   RP: 5' TTCATGCCTTCTTTCACTTTGC 3'  
SNAT2 NM_018976.4 FP: 5' TGCTGTGCCAATTCTGATCTTT 3' 185
   RP: 5' TGAGACTATGACGCCACCAACT 3'  
LAT1 NM_003486.5 FP: 5' AGGAGCCTTCCTTTCTCCTG 3' 181
   RP: 5' CTGCAAACCCTAAGGCAGAG 3'  
LAT4 NM_152346.1 FP: 5' TCTCTCCGTGCTCATCTTCA 3' 165
   RP: 5' ATTCCTGGAAAGGTGACTGC 3'  
CD98hc NM_002394.5 FP: 5' GCAGATCGACCCCAATTTTG 3' 79