Skip to main content

Table 3 Primers used for RT-PCR and qRT-PCR of ion transporter genes

From: Identification of uterine ion transporters for mineralisation precursors of the avian eggshell

Gene symbol RefSeq accession Forward primer Reverse primer
TPRV6 XM_416530 AACACCTGTGAAGGAGCTGGTGAG TCTGCTGCTTGTTTTGTTGCC
CALB1 NM_205513 CAGGGTGTCAAAATGTGTGC GCCAGTTCTGCTCGGTAAAG
ATP2A1 NM_205519 AAGGGGGGGTCTTTAAGGATGG CAAACTGCTCCACCACCAACTC
ATP2A2 XM_415130 GCAGCTTGCATATCTTTTGTGCTG CATTTCTTTCCTGCCACACTCC
ATP2A3 NM_204891 CAACCCCAAGGAGCCTCTTATC GGTCCCTCAGCGTCATACAAGAAC
ITPR1 XM_414438 AATGGCAAAAGGCGAGGAAAGC GGAGCAGCAGCAAGCGGG
ITPR2 XM_001235612 TGAGCATTGTGAGTGGCTTC GTTGACCTGGCTGTCCAAAT
ITPR3 XM_418035 AGTACAACGTGGCCCTCATC GTCGTGTCTGCTCTCCATGA
RYR1 X95266 GTTCCTCTGCATCATCGGCTAC AATTGCTGGGGAAGGACTGTG
ATP2B1 XM_416133 CTGCACTGAAGAAAGCAGATGTTG GCTGTCATATACGTTTCGTCCCC
ATP2B2 XM_001231767 TTACTGTACTTGTGGTTGCTGTCCC GGTTGTTAGCGTCCCTGTTTTG
ATP2B4 XM_418055 GCTGGTGAAGTTGTCATCCGTC TGCTCTGAAGAAAGCTGATGTTGG
SLC8A1 NM_001079473 GGATTGTGGAGGTTTGGGAAGG CTGTTTGCCAGCTCGGTATTTC
SLC8A3 XM_001231413 GGAGAGACCACAACAACAACCATTC AGCTACGAATCCATGCCCACAC
SCNN1A NM_205145 GCTTGCCAGAAAACAGTCCCTC AGTCAGACTCATCCAGGTCTTTGG
SCNN1B XM_425247 ATGGAAGTAGACCGCAGT GTTGTATGGCAGCACAGT
SCNN1G XM_414880 CAAAAGGCACTTCACCCGTTTC GGACAATGATCTTGGCTCCTGTC
ATP1A1 NM_205521 GCACAAAGAAGAAAAAGGCGAAGG GGGTGGAGGTGTAAGGGTATTTG
ATP1B1 NM_205520 TCTGGAACTCGGAGAAGAAGGAG GACGGTGAGCAACATCACTTGG
SLC4A4 XM_420603 GGAAAGCACCATTCTTCGCC CCTCCAAAAGTGATAGCATTGGTC
SLC4A5 XM_423797 TGAACGTCTCCGCTACATCCTG ACTTTATCCACCTGGCTGACTCC
SLC4A7 XM_418757 AAATTGCCAAGTTCGTGGTGG GCGAAGCAAATGAGAAGTTACGG
SLC4A9 XM_001232427 TCCTGACTGGAGTCTCTGTCTTCC AGGTGATCTGGCTGGTGTTTTG
SLC4A10 XR_026836 CGCTGATGACAGATGAGGTGTTC GGTGGTTCTATTCGGATTGTTGG
KCNJ2 NM_205370 CCATTGCTGTTTTCATGGTG TCCTGGACTTGAGGAGCTGT
KCNJ15 XM_425554 TGAGGGAAGGGAGACTCTGA GCTTCCATCCTCACTGCTTC
KCNJ16 XM_425383 CATTCCTGTTCTCCCTGGAA CATTTTAGCCAAGGCTGCTC
KCNMA1 NM_204224 GGGATGATGCGATCTGTCTT GACAAACCCACAAAGGCACT
CA2 NM_205317 ATCGTCAACAACGGGCACTCCTTC TGCACCAACCTGTAGACTCCATCC
CA4 XM_415893 GCTAACACATTTTTCCCCCTTCC CTTTATAGCACATCGCATCAGCC
CA7 XM_414152 GCACAAGTCTTATCCCATTGCC GCCGTTGTTGGAGATGTTGAGAG
SLC4A8 XM_001235579 AGAAGAAGAAGTTGGACGATGCC GGTCAGTTCTGTCCTTGCTGTTCTG
SLC26A9 XM_425821 GCCTCTTCGATGAGGAGTTTGAG CTGACCCCACCAAGAACATCAG
ATP6V1B2 XM_424534 ATTCTCTGCTGCTGGTTTGCCC CATGGACCCATTTTCCTCAAAGTC
CFTR NM_001105666 AAGAGGGCAGGGAAGATCAACGAG CGGGTTAGCTTCAGTTCAGTTTCAC
CLCN2 XM_423073 CCTGGACACCAATGTGATGCTG CACGAAGGTCTTCAGGGTGAGATAC
CLCN5 XM_420265 CGATTGGAGGAGTGCTCTTTAGTC CAAAAGGATTGATGGAACGCAG