Skip to main content

Table 1 Genes and primer sequences used for qPCR analyses

From: Cardiac responses to elevated seawater temperature in Atlantic salmon

Gene Dir. Primer sequence (5′-3′) GenBank acc. no.
HSP701 F TGACGTGTCCATCCTGACCAT BT043589.1
R CTGAAGAGGTCGGAACACATCTC
PGC1A2 F GTCAATATGGCAACGAGGCTTC FJ710605
R TCGAATGAAGGCAATCCGTC
CPT13 F TCCCACATCATCCCCTTCAACT AM230810
R TGTCCCTGAAGTGAGCCAGCT
HBB4 F ACAAACGTCAACATGGTCGACTGG EG897325.1
R TCTTTCCCCACAGGCCTACGAT
HBA5 F AAGGCAGATGTCGTCGGTGCT CK883845.1
R CAGCCCAGTGGGAGAAGTAGGTCTT
CD8A6 F CGTCTACAGCTGTGCATCAATCAA AY693391
R GGCTGTGGTCATTGGTGTAGTC
SEC137 F AGTGGGCCTGTATCAGCGACGT EG882700.1
R ATCACTGCTCGTTCGTCGCTCC
NDUFB88 F TCTGTCGCTGGGAGGAGAAGGA DW532752.1
R GTCCAGGCAGGTCCGATACTCTGT
EF1A9 F CACCACCGGCCATCTGATCTACAA AF321836
R TCAGCAGCCTCCTTCTCGAACTTC
  1. Complete gene names: 1Heat shock protein 70, 2Peroxisome proliferator-activated receptor gamma, coactivator 1, 3Carnitine palmitoyltransferase 1, 4Hemoglobin beta chain, 5Hemoglobin alpha chain, 6CD8 alpha T cell glycoprotein, 7SEC13-like protein, 8NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 9Elongation factor 1 alpha.