Skip to main content

Table 2 Primers sequences used for RT-PCR analysis of mRNA targets

From: CaMKII content affects contractile, but not mitochondrial, characteristics in regenerating skeletal muscle

mRNA target mRNA PCR primer sequence 5’→ 3’ Genbank
18S RNA Forward: CGAACGTCTGCCCTATCAACTT EU 139318.1
  Reverse: ACCCGTGGTCACCATGGTA  
COXI Forward: TGCCAGTATTAGCAGCAGGT X14848.1
  Reverse: GAATTGGGTCTCCACCTCCA  
COXIV Forward: AGTCCAATTGTACCGCATCC NM 017202.1
  Reverse: ACTCATTGGTGCCCTTGTTC  
SDHB Forward: CAGAGAAGGGATCTGTGGCT NM 001100539.1
  Reverse: TGTTGCCTCCGTTGATGTTC  
PGC-1α Forward: ATGAGAAGCGGGAGTCTGAA NM 031347.1
  Reverse: GCGCTCTTCAATTGCTTTCT  
SERCA2A Forward: GGCCCGAAACTACCTGGAGCC NM 001110139
  Reverse: CAACGCACATGCACGCACCC  
CAV3 Forward: CCCAAGAACATCAATGAGGAC U31968
  Reverse: GGAGACGGTGAAAGTGGTGT  
DYSF Forward: TGGGAACCGCTACCATCTAC NM001107869
  Reverse: CTCTGGTGCAGGAAGGAGAC