Skip to main content

Table 1 Sequence data obtained from amplicons with Kirrel3 primer set 1

From: Identification of novel Kirrel3 gene splice variants in adult human skeletal muscle

370 amplicon nucleotide sequence TARRCWACTGCTGGATMCCCCGGTCATCATCAGCTGCTTGATGGTGGAGTGCTCCTCACCCTCCCGACCAGAGGCTGGTT
CCTTGTGGACAATTTCCACTCGGATATCATTTTTGGCTGACACAACACCTTTGAGATTTCTCTGGGAACGGGCACAGCAG
AACGCCACGATGGTTGCCATAAGGACGAGGAAGGCCACACCAGCTCCTACGGCCACCCCAATGATGACGGCCATCGGCAC
AGACTCTTGCTCCTTGAGCCGGATGATCTCAGTGTCGGAGCCGAAGCTGTTCCAGGCCGTGCAGTTGTAGATGGTCTGGA
AGTCGGCAAA
400 amplicon nucleotide sequence GTRMGTACTGCTGGATTMCCCCGGTCATCATCAGCTGCTTGATGGTGGAGTGCTCCTCACCCTCCCGACCAGAGGCTGGT
TCCTTGTGGACAATTTCCACTCGGATATCATTTTTGGCTGACACAACACCTTTGAGATTTCTCTGGGAACGGGCACAGCA
GAACGCCACGATGGTTGCCATAAGGACGAGGAAGGCCACACCAGCTCCTACGGCCACCCCAATGATGACGGCCATCGGCA
CAGACTCTGGTTCCWKSCCSGSTCCCAACTTCRTTTCCGAACCTTGCTCCTTGARCCSGATGATCTCRKWGWYGGASYCG
AAGYTGKYACAGGCCGTGCAGTTGTAGATGGTCTGGAAGTCGGCA
500 nucletotide sequence GGRARWRGTCKCACGCTTCGGCTCCGACACTGAGATCATCCGGCTCAAGGAGCAAGGTTCGGAAATGAAGTCGGGAGCCG
GGCTGGAAGCAGAGTCTGTGCCGATGGCCGTCATCATTGGGGTGGCCGTAGGAGCTGGTGTGGCCTTCCTCGTCCTTATG
GCAACCATCGTGGCGTTCTGCTGTGCCCGTTCCCAGAGAAATCTCAAAGGTGTTGTGTCAGCCAAAAATGATATCCGAGT
GGAAATTGTCCACAAGGAACCAGCCTCTGGTCGGGAGGGTGAGGAGCACTCCACCATCAAGCAGCTGATGCAGAGCAACT
GGCCGGCATTTTACAATAAACGTTCAGTCAATGGAATTGAATCAKCCATGGGAGATCTCTGGTGATGCCCTCGCCCACRC
GAGATGGACCGGGGTGAATTCCAGCAAGACTCASTCCTGAAACARCTGGAGGTCCTCAAAARACACTYCCTTTYYCCCCC
CCYCCTTTAMCCCCCTTTTCTCCTCTTTTTTTTCTTCTTTT