Skip to main content

Table 1 Primers for RT-PCR

From: Claudin expression during early postnatal development of the murine cochlea

Template (v: splice variant) primers sequences product length GenBank Accession Number
18S 18S_L gaggttcgaagacgatcaga 316 X00686
  18S_R tcgctccaccaactaagaac   
Claudin-1 cldn1L cgactccttgctgaatctga 390 NM_016674
  cldn1R cgtggtgttgggtaagaggt   
Claudin-2 cldn2L ggtggcttctgtgaggacat 333 NM_016675
  cldn2R ctttcccttggcttcttgtg   
Claudin-3 cldn3L cgggagtgcttttcctgtt 344 NM_009902
  cldn3R tgctggtagtggtgacggta   
Claudin-4 cldn4L3 ccgcgacttctacaacccta 326 NM_009903
  cldn4R3 gtccccagcaagcagttagt   
Claudin-5 cldn5L2 gaagccgtgtgtggatgac 307 NM_013805
  cldn5R2 gccctttcaggttagcaggt   
Claudin-6 cldn6L1 ctactgaggctgggaggatg 363 NM_ 018777
  cldn6R1 ttgtgtgagcagggaagtgt   
Claudin-7 cldn7L1 caactgctgggcttttcaat 329 NM_ 016887
  cldn7R1 gccttcttcgctttgtcatc   
Claudin-8 cldn8L4 agccggaatcatcttcttca 399 NM_018778
  cldn8R4 cagtgtgggctccatttctc   
Claudin-9 cldn9L2 tactccatcccttcccgttc 331 NM_ 020293
  cldn9R2 ctgaggtccaggttccagag   
Claudin-10v1 cldn10v1L2 gggatttttcggttccattt 378 NM_023878
  cldn10v1R2 tctccttctccgccttgata   
Claudin-10v2 cldn10v2L tttttcggttccatttttgc 375 NM_ 021386
  cldn10v2R atctccttctccgccttgat   
Claudin-11 cldn11L2 gccgaaaaatggacgaact 315 NM_008770
  cldn11R2 gggcacatacaggaaaccag   
Claudin-12 cldn12L3 cagatgtgctcctgttgcat 304 NM_022890
  cldn12R3 cccgtgtaaatcgtcaggtt   
Claudin-13 cldn13L2 tcgggaaaacaggtggatac 385 NM_020504
  cldn13R2 gttgacacagagcaggatgc   
Claudin-14 cldn14L3 ctgggcttcatctcctcatc 332 NM_ 019500
  cldn14R3 aagagcacctccttccctgt   
Claudin-15 cldn15L2 aagacggcagacaagaatcg 305 NM_021719
  cldn15R2 caaagatggtgttggtggtg   
Claudin-16 cldn16L1 gcagggaccacattactcatt 389 NM_053241
  cldn16R1 taaacggcacaggaacacag   
Claudin-17 cldn17L11 ggctgaagcagtaggccaag 314 NM_181490
  cldn17R11 tgagagcaaccaaggcaaga   
Claudin-18 cldn18L4 gaacccttccccaagaagag 355 NM_019815
   caagctggaaaatcgaccat   
Claudin-19v1 cldn19v1L gaagggctgtggatgtcttg 321 NM_001038590
  cldn19v1R aggagtgctggggttgaag   
Claudin-19v2 cldn19v2L2 tgctggctacatcttgtggt 306 NM_153105
  cldn19v2R2 gacagttgaatggggttgct   
Claudin-20 cldn20L2 cagctccttgctttcatcct 356 NM_001101560
  cldn20R2 aagcagactcctccagcaaa   
Claudin-22 cldn22L2 ggcttggagagacacaggag 342 NM_029383
  cldn22R2 tttctggattggcttgcttc   
Claudin-23 cldn23L2 tactacagcgacggacagca 320 NM_027998
  cldn23R2 cagttagaggaaggcgacca