Skip to main content

Table 2 Sequence data obtained from amplicons with Kirrel3 primer set 2

From: Identification of novel Kirrel3 gene splice variants in adult human skeletal muscle

610 nucleotide sequence AATARMATTGMGAGAGCTATGTGTTCATCCAAAATGCTGGCTGCCCTGCAGATGAAGTTCAGTCTAGTCCAGGTCAACCT
CAGCCTAGCGCCCACTCTGCCAGGCGCCATGTTGCCCAGGCTCACATACACCGATGCATCAGACCCACTCCCTGCCCCAG
GAGCTCACAGCACTGTTAGGACCCCTGTTCATTGCACTCCTGCTTACTTGCTCTCCGGGGCAGCCTAAGCCTGGCCTTTT
TCTCTGTCCCCCTCCCTGAGATCCCGGATCTCCCTCCCGTACTTCTCTGGGAACGGGCACAGCAGAACGCCACGATGGTT
GCCATAAGGACGAGGAAGGCCACACCAGCTCCTACGGCCACCCCAATGATGACGGCCATCGGCACAGACTCTKGTTCCWK
GCSSGSTACGAACTTCRTGTCCGARCCTAGSTCCTTGARSGSCATGATSTCGKWGATGGASTGGAAGYTGKYCCRSGCCA
TGYWGYTGATGATGGKGTGGAAGATGACCCCCTCSATGKTGCTGATGGTCWCGRYCGAAAAGAGRCCCTCCT
590 nucleotide sequence CATTCGATCGATTRSCGMKAGAGCWTGTGTTCATCCAAATGCTGGCTGCCCTGCAGATGAAGTTCAGTCTAGTCCAGGTC
AACCTCAGCCTAGCGCCCACTCTGCCAGGCGCCATGTTGCCCAGGCTCACATACACCGATGCATCAGACCCACTCCCTGC
CCCAGGAGCTCACAGCACTGTTAGGACCCCTGTTCATTGCACTCCTGCTTACTTGCTCTCCGGGGCAGCCTAAGCCTGGC
CTTTTTCTCTGTCCCCCTCCCTGAGATCCCGGATCTCCCTCCCGTACTTCTCTGGGAACGGGCACAGCAGAACGCCACGA
TGGTTGCCATAAGGACGAGGAAGGCCACACCAGCTCCTACGGCCACCCCAATGATGACGGCCATCGGCACAGACTCTTGC
TCCTTGAGCCGGATGATCTCAGTGTCGGAGCCGAAGCTGTTCCAGGCCGTGCAGTTGTAGATGGTCTGGAAGTCGGCCCG
CACGATGTTGCTGATGGTCAGGGTGGAGATGACGCCCTCCTCGGTGCTGATGGTCTCCACCGTATAGCGA