Skip to main content

Table 1 Primer and probe sequences for quantitative real-time RT-PCR

From: Short-term overfeeding of zebrafish with normal or high-fat diet as a model for the development of metabolically healthy versus unhealthy obesity

Gene Symbol Gene Full name Method Primer Probe (5’-FAM, 3’-TAMRA)
pparg peroxisome proliferator-activated receptor gamma TAQMAN F 5‘-GCTGCACAGGCGCTTCA
R 5‘-CTCCAGCTCCTCCAGTTCCA
CAGAAAGCTTCACTCTCCGCTGATATGGTG
fabp11a fatty acid binding protein 11a TAQMAN F 5‘-GGTTGACAAATTCGTAGGAACGT
R 5‘-AACCCACACCTATAGCCTTCATG
AATGACCACCAGCGACAACTTTGACGA
fasn fatty acid synthase TAQMAN F 5‘-ACACGGTTCACGCATTTGTG
R 5‘-GACCCATCTTCCGTAGCATATCA
AGCTATTCAGGTTGCCCAGA
srebf1 sterol regulatory element binding transcription factor 1 TAQMAN Predesigned
(Dr03093012_m1; Thermo Fisher)
 
atgl adipose triglyceride lipase SYBR Green F 5‘-GCGTGACGGATGGAGAAA
R 5‘-AGGCCACAGTAAACAGGAATAT
 
hsl hormone-sensitive lipase SYBR Green F 5‘-CGGCAAGGACAGGACAGT
R 5‘-GCATGGAGAAAGAGGAGCT
 
lpl lipoprotein lipase TAQMAN F 5‘-CTGAGGGCTCTCGTTCATAAAGA
R 5‘-AATCCATCAAAGACTGTAACTTCAATACA
CTCTCAAACATACCCGTGACCGTCCATC
il1b interleukin 1 beta TAQMAN F 5‘- TCATCGCCCTGAACAGAATG
R 5‘-TCACTTCACGCTCTTGGATGAC
AGCACATCAAACCCCAATCCACAGAGTT
tnfa tumor necrosis factor alpha TAQMAN Predesigned
(Dr03126848_g1; Thermo Fisher)
 
col1a1a collagen, type I, alpha 1a SYBR Green F 5‘-GCTTTTGGCAAGAGGACAAG
R 5‘-TGTCTTCGCAGATCACTTCG
 
bactin2 beta-actin 2 TAQMAN F 5‘-TCCCCTTGTTCACAATAACCTACTAA
R 5‘-CATACCGGAGCCGTTGTCA
AGCGATTTCCTCATCCATGGCTGTGT
tbp TATA-box binding protein TAQMAN F 5‘-CCTGCGAATTATCGTTTACGTCTT
R 5‘-ACGGCATCATAGGACTGAAAATG
TTGCTTCATAACCTGTCAGCATGGAGCA